Matching SomaliNet's DNA research to Hallenberg 2005 Study

[James Dahl]

https://spreadsheets.google.com/pub?key ... utput=html

I have matched them up, some people are from ysearch.org not SomaliNet but they are from Somalia, so I do not know the clans and so have put "Uncertain1" and "Uncertain2".

AbdiWahab252's results match the third most common haplotype, which I have dubbed the temporary name "Modal E1b1b1a1b-HabarGidir" for lack of a better name. It is not known at this time if this is in fact the modal haplotype of all of Hawiye or indeed only Habar Gidir, as AbdiWahab252 is the only known Hawiye to have gotten his results back.

hyperactive's results do not match any haplotype in the Hallenberg study, so it is a newly observed haplotype! That said it is close to many other Somali haplotypes in the study, and only has one marker that is "out of the ordinary".

IRONm@n's results match a haplotype that is tied for fourth most common in the Hallenberg study with three other haplotypes also having 9 examples of the haplotype, and so I have dubbed their haplotype "Modal E1b1b1a1b-Ogaden", for lack of a better name as hyperactive is the only fellow I know the clan of.

[Murax]

James,

What is the difference between Hyperactive/Ironman's results and Abdiwahab's?

[AhlulbaytSoldier]

i still cant believe that this guy is cadaan

[James Dahl]

Basically, your Y chromosome is made up of a number of segments that have been identified and assigned numbers, DYS stands for DNA Y-chromosome Segment.

This segment is made up of a series of Deoxyribonucleic acids, adenine (abbreviated A), cytosine (C), guanine (G) and thymine (T).

The difference is for instance at the end of DNA Y-chromosome Segment #439 on hyperactive and IRONm@n's test, there is a short tandem repeat on this segment of "GATA" (guanine-adenine-thymine-adenine) that repeats 11 times:
GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

Whereas on AbdiWahab252's test, there has been a small mutation, and his short tandem repeat on DYS439 repeats 12 times:
GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

Some STR's mutate faster than others, and DYS439 is a faster-mutating STR. In fact, DYS439 is the most common mutation difference, so it is possible that AbdiWahab and IRONm@n and hyperactive share a common ancestor in historical times. However, at 12 markers this is conjecture, it's easier to say with 64 markers.

[Abdihaliim]

i still cant believe that this guy is cadaan

He has 100 names:
1) James
2) Dawwa
3)******'

and so on!
And he has 3 haplogroups
a) I
b) E
c) J

[James Dahl]

i still cant believe that this guy is cadaan

He has 100 names:
1) James
2) Dawwa
3)******'

and so on!
And he has 3 haplogroups
a) I
b) E
c) J

Every 6 months or so I am accused of being someone else, it's rather strange.

[Murax]

James Dahl,

How about Hyperactive and Ironman's results? Do they most likely share a anscestor in the past 1000-2000 years?

[James Dahl]

James Dahl,

How about Hyperactive and Ironman's results? Do they most likely share a anscestor?

Absolutely, that goes without saying, I mean while AbdiWahab252 has a near perfect match with only a rapidly-mutating STR the difference, hyperactive and IRONm@n have and exact match at 12 markers.
At 12 markers though how distant that ancestor is becomes the issue, not whether there is one. You cannot say with any level of precision how many generations ago the common ancestor was at 12 markers, though at 64 markers you can say with better precision.

[King-of-Awdal]

What does it mean if u get 28.1% J2a-M410 or J2a4a

[Abdihaliim]

James Dahl,

How about Hyperactive and Ironman's results? Do they most likely share a anscestor in the past 1000-2000 years?

Most of you are going to M78 or M86, but me and Hyper stop at M35, so do you have more info about M35 and not M78?
Abdihalim here is my complete repeats. do you take the test, or you study in DNA, it looks like you interested in them.
Tandem Repeats

DYS19 ---11 repeats
DYS392 ---12 repeats
DYS 390 --24 repeats
DYS388----12 repeats
DYS389-2-- 18 repeats
DYS389-1---13 repeats
DYS385a----16 repeats
DYS 385b ---18 repeats
DYS 393 ---13 repeats
DYS 391---- 10 repeats
DYS 439-----11 repeats
DYS 426-----11 repeats

Abdiwahaab/IRONm@N" 11/12 match

[Hyperactive]

james me amd ironman differe 2 repeats, does that matters bro?
dont mind me, i dont understand at all.

i know isaq guy who took it and we differe 2 also.

[AbdiWahab252]

So James, does this mean I have no Semitic ancestry ?

[James Dahl]

So James, does this mean I have no Semitic ancestry ?

This test can't tell that, it can only tell your male-line descent, your abtiris in other words.
It can't tell if any of those ancestors married Arab brides.

[James Dahl]

james me amd ironman differe 2 repeats, does that matters bro?
dont mind me, i dont understand at all.

i know isaq guy who took it and we differe 2 also.

Which ones are different?
Let me know which ones were different on the Isaaq test as well

[Abdihaliim]

James
Isse Raghe. His DYS439 = 12 Not 11.